ADHDgene Database
  • Hot Results
  • Quick Search
Keyword:
Type:
  • Large-scale studies
  • Data Summary
  • Published Variant
  • Published Gene: 359
  • Published Region: 128
  • Pathway by PBA: 8
  • Study: 361

SNP Report

Basic Info
Name rs4795541 dbSNP Ensembl
Location Chr17:28564360(Fwd)
Variant Alleles -/G/A/AGATGCTGGGGGGGCTGCAGGGGGGATGCTGGGGGTGCAGGGG
Functional Annotation upstream_gene_variant.
Consequence to Transcript upstream_gene_variant(ENST00000261707; ENST00000401766; ENST00000394821; ENST00000577420)
No. of Studies 1 (significant: 0; non-significant: 1; trend: 0)
Source Literature-origin

SNP related studies (count: 1)
Reference Allele Change Risk Allele Statistical Values Author Comments Result of Statistical Analysis
Forero DA, 2009 Not significant for the total samples. Not significant for the total samples. Non-significant

SNP related genes (count: 1)

Literature-origin genes (count: 1)

Genes from other sources Help (count: 0)


SNPs in LD with rs4795541 (count: 0) View in gBrowse (chr17:28564360..28564360 )

Copyright: Bioinformatics Lab, Institute of Psychology, Chinese Academy of Sciences Feedback
Last update: Feb 26, 2014