- Hot Results
- Quick Search
- Large-scale studies
- Genome-wide Association Studies of ADHD
- Genome-wide Linkage Studies of ADHD
- Genome-wide CNV Analyses of ADHD
- Meta-analysis Studies of ADHD
- Data Summary
SNP Report
Name | rs4795541 dbSNP Ensembl | ||
---|---|---|---|
Location | Chr17:28564360(Fwd) | ||
Variant Alleles | -/G/A/AGATGCTGGGGGGGCTGCAGGGGGGATGCTGGGGGTGCAGGGG | ||
Functional Annotation | upstream_gene_variant. | ||
Consequence to Transcript | upstream_gene_variant(ENST00000261707; ENST00000401766; ENST00000394821; ENST00000577420) | ||
No. of Studies | 1 (significant: 0; non-significant: 1; trend: 0) | ||
Source | Literature-origin |