ADHDgene Database

Hot Results

Quick Search

Keyword:
Type:

Large-scale studies

Data Summary

Published Variant
- SNP: 1391
- CNV: 398
- Others: 173
Published Gene: 359
Published Region: 128
Pathway by PBA: 8
Study: 361

Study Report

Basic Info

Reference	Chaste P, 201121615493
Citation	Chaste P., Clement N., Botros H. G., Guillaume J. L., Konyukh M., Pagan C., Scheid I., Nygren G., Anckarsater H., Rastam M., Stahlberg O., Gillberg I. C., Melke J., Delorme R., Leblond C., Toro R., Huguet G., Fauchereau F., Durand C., Boudarene L., Serrano E., Lemiere N., Launay J. M., Leboyer M., Jockers R., Gillberg C. and Bourgeron T. (2011) "Genetic variations of the melatonin pathway in patients with attention-deficit and hyperactivity disorders." J Pineal Res, 51(4): 394-399.
Study Design	case-control
Study Type	Mutational study
Sample Size	101 cases, 220 controls
Predominant Ethnicity	Caucasian
Population	Sweden
Gender	59 men, 42 women in case group; 142 men, 78 women in control group

Detail Info

Summary	Melatonin is a powerful antioxidant and a synchronizer of many physiological processes. Alteration in melatonin signaling has been reported in a broad range of diseases, but little is known about the genetic variability of this pathway in humans. Here, they sequenced all the genes of the melatonin pathway - AA-NAT, ASMT, MTNR1A, MTNR1B and GPR50 - in 321 individuals from Sweden including 101 patients with attention-deficit/hyperactivity disorder (ADHD) and 220 controls from the general population. They find several damaging mutations in patients with ADHD, but no significant enrichment compared with the general population. Among these variations, they found a splice site mutation in ASMT (IVS5+2T>C) and one stop mutation in MTNR1A (Y170X) - detected exclusively in patients with ADHD - for which biochemical analyses indicated that they abolish the activity of ASMT and MTNR1A. These genetic and functional results represent the first comprehensive ascertainment of melatonin signaling deficiency in ADHD.
Total Sample	ADHD had been assigned as 'main diagnosis' in all 101 participants in the ADHD group, but the vast majority had comorbid disorders (e.g. 53% had a history of mood disorder or major depressive disorder 39%; Table S1). Unrelated Swedish participants without ADHD (n=220, 142 men, 78 women) were recruited through advertisements. All individuals included are of European ancestry. The local research ethics boards reviewed and approved the study. Informed consent was obtained from all participants.
Sample Collection	Unrelated Swedish participants with DSM-IV-TR ADHD (n=101, 59 men, 42 women) were recruited at the Sahlgren University Hospital in Goteborg. Unrelated Swedish participants without ADHD (n=220, 142 men, 78 women) were recruited through advertisements.
Diagnosis Description	The participants with DSM-IV-TR ADHD were diagnosed after personal interview, clinical examination and comprehensive testing by an experienced psychiatrist and a neuropsychologist, and after collateral interview with a close family member. The instruments used included SCID-I, SCID-tII, ADHD-RS, and DSM-IV-checklists. The participants without ADHD didn't undergo extensive neuropsychiatric assessment, but had confirmed, in face to face interviews, that they did not have a diagnosis for ADHD. The presence of sleep problems in controls was not ascertained.
Technique	All PCR and sequencing of ASMT , MTNR1A/B , and GPR50 were performed as previously described (Chaste P, et. al., 2010; Melke J, et. al., 2008) For AA-NAT , amplification of both exons was performed in a single PCR of 1655 bp with primers AA-NAT F:GAATGTGCCCATTGATTTAGG and AA-NAT R-GCCCGGTCTCAGGTACAGAGT. PCR products were sequenced with the BigDye Terminator Cycle Sequencing kit (V3.1; Applied Biosystems, Courtaboeuf, France). Samples were then subjected to electrophoresis, using an ABI PRISM genetic analyzer (Applied Biosystems). For all nonsynonymous mutations, genotyping was confirmed by the sequence of an independent PCR product.
Analysis Method	To test whether there was an enrichment of MTNR1A and MTNR1B mutations in patients compared to controls, each group was divided in three subgroups of individuals carrying 0, 1 or 2 coding variations. Enrichment was tested using a chi-square test. The X-linked GPR50 gene was analyzed separately by comparing allelic distribution in case and controls after stratification by sex. For more information about the functional analyses of the melatonin pathway, please refer to the original publication. Statistical differences between wild-type and mutant AA-NAT, ASMT, and MTNR1A activities were tested using a two-tailed t-test.
Result Description	They detected variations modifying the protein sequence in the five main genes required for both melatonin synthesis (AA-NAT and ASMT) and signaling (MTNR1A, MTNR1B, and GPR50). All coding variations in GPR50 were frequent poymorphisms. No significant enrichment of coding variations in MTNR1A and MTNR1B was observed in patients with ADHD compared with controls. Interestingly, one splice site mutation of ASMT (IVS5+2T>C) and one stop mutation in MTNR1A (Y170X) were predicted to cause severe functional alterations and were detected in two independent patients with ADHD, but not in the geographically matched comparison group. For the variations identified in patients, measurements of the recombinant enzyme activities indicated that AA-NAT V62I did not change the overall activity whereas A163V caused twofold reduction. Measurements of ASMT activity indicated that the G219X stop mutation (IVS5+2T>C) and the L298F variation strongly affected enzyme activity. Interestingly, the AA-NAT G177D and the ASMT D210G variations detected here in the controls were also shown to alter enzyme activity.

Other variant reported by this study (count: 18)

Variant Name	Allele Change	Risk Allele	Statistical Values	Author Comments	Result of Statistical Analysis
ASMT L298F	C/T		measurements of the recombinant enzyme activities, t-test measurements of the recombinant enzyme activities, t-test P-value=0.008 More...	modify the protein sequence; strongly affected enzyme activity (P-value=0.008)	Trend
MTNR1A C/G Y170X	C/G		no data no data	modify the protein sequence; but no significant enrichment; this mutation was predicted to cause severe functional alterations and were detected in two independent patients with ADHD, but not in the geographically matched comparison group.	Significant
MTNR1A A/T K334N	A/T		no data no data	modify the protein sequence; but no significant enrichment.	Trend
MTNR1B C/T R138C	C/T		no data no data	modify the protein sequence; but no significant enrichment.	Trend
MTNR1B A/G K243R	A/G		no data no data	modify the protein sequence; but no significant enrichment.	Trend
MTNR1A G/A G166E	G/A		no data no data	modify the protein sequence; but no significant enrichment.	Trend
MTNR1A C/T A266V	C/T		no data no data	modify the protein sequence; but no significant enrichment.	Trend
MTNR1B G/A G24E	G/A		no data no data	As control.	Trend
MTNR1B G/A R231H	G/A		no data no data	modify the protein sequence; but no significant enrichment.	Trend
GPR50 S493R	G/A		no data no data	frequent poymorphism; modify the protein sequence	Trend
GPR50 T532A	A/G		no data no data	frequent poymorphism; modify the protein sequence	Trend
AANAT G177D	G/A		measurements of the recombinant enzyme activities, t-test measurements of the recombinant enzyme activities, t-test P-value=0.004 More...	modify the protein sequence; detected in the controls and also shown to alter enzyme activity (P-value=0.004)	Trend
AANAT A163V	C/T		measurements of the recombinant enzyme activities, t-test P-...... measurements of the recombinant enzyme activities, t-test P-value=0.08 More...	modify the protein sequence; caused twofold reduction of the recombinant enzyme activity (P-value=0.08)	Trend
AANAT V62I	G/A		no data no data	As control; did not change the overall enzyme activity	Trend
GPR50 Del502-505	Ins/Del		no data no data	frequent poymorphism; modify the protein sequence	Trend
GPR50 I606V	G/A		no data no data	frequent poymorphism; modify the protein sequence	Trend
ASMT IVS5+2T>C	T/C		measurements of the recombinant enzyme activities, t-test P-...... measurements of the recombinant enzyme activities, t-test P-value=0.007 More...	modify the protein sequence; strongly affected enzyme activity (P-value=0.007); this mutation was predicted to cause severe functional alterations and were detected in two independent patients with ADHD, but not in the geographically matched comparison group.	Significant
ASMT D210G	A/G		measurements of the recombinant enzyme activities, t-test measurements of the recombinant enzyme activities, t-test P-value=0.007 More...	modify the protein sequence; detected in the controls and also shown to alter enzyme activity (P-value=0.007)	Trend

Genes reported by this study (count: 5)

Gene	Statistical Values/Author Comments	Result of Statistical Analysis
AANAT	Several damaging mutations were found in patients with ADHD,...... Several damaging mutations were found in patients with ADHD, but no significant enrichment compared with the general population. More...	Trend
MTNR1B	Several damaging mutations were found in patients with ADHD,...... Several damaging mutations were found in patients with ADHD, but no significant enrichment compared with the general population. More...	Trend
GPR50	Several damaging mutations were found in patients with ADHD,...... Several damaging mutations were found in patients with ADHD, but no significant enrichment compared with the general population. More...	Trend
MTNR1A	One stop mutation in MTNR1A (Y170X) was found and was detect...... One stop mutation in MTNR1A (Y170X) was found and was detected exclusively in patients with ADHD-for which biochemical analyses indicated that it abolish the activity of MTNR2A. More...	Significant
ASMT	A splice site mutation in ASMT (IVS5+2T>C) was found and als...... A splice site mutation in ASMT (IVS5+2T>C) was found and also was detected exclusively in patients with ADHD - for which biochemical analyses indicated that it abolish the activity of ASMT. More...	Significant